Review





Similar Products

86
Sangon Biotech human slc7a1 1 rna primers f tcctgctttggctccatgaacg r agaggagtgtgcttgcggacat
Human Slc7a1 1 Rna Primers F Tcctgctttggctccatgaacg R Agaggagtgtgcttgcggacat, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human slc7a1 1 rna primers f tcctgctttggctccatgaacg r agaggagtgtgcttgcggacat/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
human slc7a1 1 rna primers f tcctgctttggctccatgaacg r agaggagtgtgcttgcggacat - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Sangon Biotech human nfe2l2 nrf2 rna primers f tccagtcagaaaccagtggat r gaatgtctgcgccaaaagctg
Human Nfe2l2 Nrf2 Rna Primers F Tccagtcagaaaccagtggat R Gaatgtctgcgccaaaagctg, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human nfe2l2 nrf2 rna primers f tccagtcagaaaccagtggat r gaatgtctgcgccaaaagctg/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
human nfe2l2 nrf2 rna primers f tccagtcagaaaccagtggat r gaatgtctgcgccaaaagctg - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Sangon Biotech human slc31a1 rna primers f ccaggaccaaatggaaccatcc r accacctggatgatgtgcagca
Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and <t>SLC31A1</t> knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.
Human Slc31a1 Rna Primers F Ccaggaccaaatggaaccatcc R Accacctggatgatgtgcagca, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human slc31a1 rna primers f ccaggaccaaatggaaccatcc r accacctggatgatgtgcagca/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
human slc31a1 rna primers f ccaggaccaaatggaaccatcc r accacctggatgatgtgcagca - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Sangon Biotech universal u6 primer f
Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and <t>SLC31A1</t> knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.
Universal U6 Primer F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/universal u6 primer f/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
universal u6 primer f - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Sangon Biotech primer gapdh f gggtgtgaaccatgagaagt
Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and <t>SLC31A1</t> knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.
Primer Gapdh F Gggtgtgaaccatgagaagt, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer gapdh f gggtgtgaaccatgagaagt/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
primer gapdh f gggtgtgaaccatgagaagt - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Sangon Biotech primer prpf31 f agaacccagagccagaagga
The <t>VIM-PRPF31-ARG1</t> three-gene signature exhibits high diagnostic accuracy for IS (A and B) Receiver operating characteristic (ROC) curves demonstrating the discriminatory power of the three-gene signature in the GSE22255 -58294 training cohort. The area under the curve (AUC) values indicates high diagnostic accuracy. (C and D) ROC curves validating the diagnostic efficacy of the three-gene signature in the independent validation cohort GSE16561 -37587. (E, F, and G) Validation of differential expression patterns of VIM (E), PRPF31 (F) , and ARG1 (G) between normal controls and ischemic stroke samples in the GSE16561 -37587 dataset. ∗ p < 0.05, ∗∗ p < 0.01 by Wilcoxon rank-sum test.
Primer Prpf31 F Agaacccagagccagaagga, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer prpf31 f agaacccagagccagaagga/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
primer prpf31 f agaacccagagccagaagga - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Sangon Biotech primer cd44 f sequence 5 ctgccgctttgcaggtgta 3
The <t>VIM-PRPF31-ARG1</t> three-gene signature exhibits high diagnostic accuracy for IS (A and B) Receiver operating characteristic (ROC) curves demonstrating the discriminatory power of the three-gene signature in the GSE22255 -58294 training cohort. The area under the curve (AUC) values indicates high diagnostic accuracy. (C and D) ROC curves validating the diagnostic efficacy of the three-gene signature in the independent validation cohort GSE16561 -37587. (E, F, and G) Validation of differential expression patterns of VIM (E), PRPF31 (F) , and ARG1 (G) between normal controls and ischemic stroke samples in the GSE16561 -37587 dataset. ∗ p < 0.05, ∗∗ p < 0.01 by Wilcoxon rank-sum test.
Primer Cd44 F Sequence 5 Ctgccgctttgcaggtgta 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer cd44 f sequence 5 ctgccgctttgcaggtgta 3/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
primer cd44 f sequence 5 ctgccgctttgcaggtgta 3 - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Sangon Biotech primer vim f gacgccatcaacaccgagt
The <t>VIM-PRPF31-ARG1</t> three-gene signature exhibits high diagnostic accuracy for IS (A and B) Receiver operating characteristic (ROC) curves demonstrating the discriminatory power of the three-gene signature in the GSE22255 -58294 training cohort. The area under the curve (AUC) values indicates high diagnostic accuracy. (C and D) ROC curves validating the diagnostic efficacy of the three-gene signature in the independent validation cohort GSE16561 -37587. (E, F, and G) Validation of differential expression patterns of VIM (E), PRPF31 (F) , and ARG1 (G) between normal controls and ischemic stroke samples in the GSE16561 -37587 dataset. ∗ p < 0.05, ∗∗ p < 0.01 by Wilcoxon rank-sum test.
Primer Vim F Gacgccatcaacaccgagt, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer vim f gacgccatcaacaccgagt/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
primer vim f gacgccatcaacaccgagt - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Sangon Biotech primer krt15 f sequence 5 tctgctaggtttgtctcttcagg 3
The <t>VIM-PRPF31-ARG1</t> three-gene signature exhibits high diagnostic accuracy for IS (A and B) Receiver operating characteristic (ROC) curves demonstrating the discriminatory power of the three-gene signature in the GSE22255 -58294 training cohort. The area under the curve (AUC) values indicates high diagnostic accuracy. (C and D) ROC curves validating the diagnostic efficacy of the three-gene signature in the independent validation cohort GSE16561 -37587. (E, F, and G) Validation of differential expression patterns of VIM (E), PRPF31 (F) , and ARG1 (G) between normal controls and ischemic stroke samples in the GSE16561 -37587 dataset. ∗ p < 0.05, ∗∗ p < 0.01 by Wilcoxon rank-sum test.
Primer Krt15 F Sequence 5 Tctgctaggtttgtctcttcagg 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer krt15 f sequence 5 tctgctaggtttgtctcttcagg 3/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
primer krt15 f sequence 5 tctgctaggtttgtctcttcagg 3 - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Sangon Biotech primer arg1 f tgctgaaggacacctttgct
The <t>VIM-PRPF31-ARG1</t> three-gene signature exhibits high diagnostic accuracy for IS (A and B) Receiver operating characteristic (ROC) curves demonstrating the discriminatory power of the three-gene signature in the GSE22255 -58294 training cohort. The area under the curve (AUC) values indicates high diagnostic accuracy. (C and D) ROC curves validating the diagnostic efficacy of the three-gene signature in the independent validation cohort GSE16561 -37587. (E, F, and G) Validation of differential expression patterns of VIM (E), PRPF31 (F) , and ARG1 (G) between normal controls and ischemic stroke samples in the GSE16561 -37587 dataset. ∗ p < 0.05, ∗∗ p < 0.01 by Wilcoxon rank-sum test.
Primer Arg1 F Tgctgaaggacacctttgct, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer arg1 f tgctgaaggacacctttgct/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
primer arg1 f tgctgaaggacacctttgct - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

Image Search Results


Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Knockdown, Imaging, Gene Expression, shRNA, Control, Western Blot, Activity Assay

Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Knockdown, Staining, Transmission Assay, Electron Microscopy, Imaging, shRNA, Transfection, Plasmid Preparation, Western Blot

SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Knockdown, shRNA, Transfection, Western Blot, Staining

SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Plasmid Preparation, Transfection, Western Blot, Knockdown, shRNA, Staining

Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Generated, Binding Assay, Knockdown, Activity Assay, Western Blot, shRNA, Transfection, Plasmid Preparation

Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Western Blot, Knockdown, shRNA, Transfection, Plasmid Preparation

Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Activation Assay, Knockdown, shRNA, Transfection, Staining

Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Activation Assay, Knockdown, Transfection, shRNA, Staining, Plasmid Preparation

SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Knockdown, In Vivo, Immunohistochemical staining, Staining

The VIM-PRPF31-ARG1 three-gene signature exhibits high diagnostic accuracy for IS (A and B) Receiver operating characteristic (ROC) curves demonstrating the discriminatory power of the three-gene signature in the GSE22255 -58294 training cohort. The area under the curve (AUC) values indicates high diagnostic accuracy. (C and D) ROC curves validating the diagnostic efficacy of the three-gene signature in the independent validation cohort GSE16561 -37587. (E, F, and G) Validation of differential expression patterns of VIM (E), PRPF31 (F) , and ARG1 (G) between normal controls and ischemic stroke samples in the GSE16561 -37587 dataset. ∗ p < 0.05, ∗∗ p < 0.01 by Wilcoxon rank-sum test.

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: The VIM-PRPF31-ARG1 three-gene signature exhibits high diagnostic accuracy for IS (A and B) Receiver operating characteristic (ROC) curves demonstrating the discriminatory power of the three-gene signature in the GSE22255 -58294 training cohort. The area under the curve (AUC) values indicates high diagnostic accuracy. (C and D) ROC curves validating the diagnostic efficacy of the three-gene signature in the independent validation cohort GSE16561 -37587. (E, F, and G) Validation of differential expression patterns of VIM (E), PRPF31 (F) , and ARG1 (G) between normal controls and ischemic stroke samples in the GSE16561 -37587 dataset. ∗ p < 0.05, ∗∗ p < 0.01 by Wilcoxon rank-sum test.

Article Snippet: Primer Prpf31 F: AGAACCCAGAGCCAGAAGGA , This paper , Sangon Biotech.

Techniques: Diagnostic Assay, Biomarker Discovery, Quantitative Proteomics

Key candidate biomarkers modulate immune cell infiltration during post-stroke recovery (A) Comparison of immune cell infiltration abundances between DAC subtypes. (B) Correlation network depicting significant interactions among immune cells by ssGSEA. (C) Correlation heatmap depicting associations of VIM , ARG1 , and PRPF31 with infiltrating immune infiltration cells. ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05 by Wilcoxon rank-sum test.

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Key candidate biomarkers modulate immune cell infiltration during post-stroke recovery (A) Comparison of immune cell infiltration abundances between DAC subtypes. (B) Correlation network depicting significant interactions among immune cells by ssGSEA. (C) Correlation heatmap depicting associations of VIM , ARG1 , and PRPF31 with infiltrating immune infiltration cells. ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05 by Wilcoxon rank-sum test.

Article Snippet: Primer Prpf31 F: AGAACCCAGAGCCAGAAGGA , This paper , Sangon Biotech.

Techniques: Comparison

Relative mRNA expression levels of Arg1 , Vim , and Prpf31 : Comparison between MCAO rats and healthy control rats (A–C) Relative mRNA expression levels of Arg1 (A), Vim (B), and Prpf31 (C) in MCAO rats vs. healthy control rats. ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05 by Wilcoxon rank-sum test.

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Relative mRNA expression levels of Arg1 , Vim , and Prpf31 : Comparison between MCAO rats and healthy control rats (A–C) Relative mRNA expression levels of Arg1 (A), Vim (B), and Prpf31 (C) in MCAO rats vs. healthy control rats. ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05 by Wilcoxon rank-sum test.

Article Snippet: Primer Prpf31 F: AGAACCCAGAGCCAGAAGGA , This paper , Sangon Biotech.

Techniques: Expressing, Comparison, Control

The VIM-PRPF31-ARG1 three-gene signature exhibits high diagnostic accuracy for IS (A and B) Receiver operating characteristic (ROC) curves demonstrating the discriminatory power of the three-gene signature in the GSE22255 -58294 training cohort. The area under the curve (AUC) values indicates high diagnostic accuracy. (C and D) ROC curves validating the diagnostic efficacy of the three-gene signature in the independent validation cohort GSE16561 -37587. (E, F, and G) Validation of differential expression patterns of VIM (E), PRPF31 (F) , and ARG1 (G) between normal controls and ischemic stroke samples in the GSE16561 -37587 dataset. ∗ p < 0.05, ∗∗ p < 0.01 by Wilcoxon rank-sum test.

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: The VIM-PRPF31-ARG1 three-gene signature exhibits high diagnostic accuracy for IS (A and B) Receiver operating characteristic (ROC) curves demonstrating the discriminatory power of the three-gene signature in the GSE22255 -58294 training cohort. The area under the curve (AUC) values indicates high diagnostic accuracy. (C and D) ROC curves validating the diagnostic efficacy of the three-gene signature in the independent validation cohort GSE16561 -37587. (E, F, and G) Validation of differential expression patterns of VIM (E), PRPF31 (F) , and ARG1 (G) between normal controls and ischemic stroke samples in the GSE16561 -37587 dataset. ∗ p < 0.05, ∗∗ p < 0.01 by Wilcoxon rank-sum test.

Article Snippet: Primer Arg1 F: TGCTGAAGGACACCTTTGCT , This paper , Sangon Biotech.

Techniques: Diagnostic Assay, Biomarker Discovery, Quantitative Proteomics

Key candidate biomarkers modulate immune cell infiltration during post-stroke recovery (A) Comparison of immune cell infiltration abundances between DAC subtypes. (B) Correlation network depicting significant interactions among immune cells by ssGSEA. (C) Correlation heatmap depicting associations of VIM , ARG1 , and PRPF31 with infiltrating immune infiltration cells. ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05 by Wilcoxon rank-sum test.

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Key candidate biomarkers modulate immune cell infiltration during post-stroke recovery (A) Comparison of immune cell infiltration abundances between DAC subtypes. (B) Correlation network depicting significant interactions among immune cells by ssGSEA. (C) Correlation heatmap depicting associations of VIM , ARG1 , and PRPF31 with infiltrating immune infiltration cells. ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05 by Wilcoxon rank-sum test.

Article Snippet: Primer Arg1 F: TGCTGAAGGACACCTTTGCT , This paper , Sangon Biotech.

Techniques: Comparison

Mendelian randomization identifies ARG1 as a causal protective factor for IS (A) Forest plot of MR model results. (B) Scatterplot of the five MR models. Each point represents an IV, with the line on each point indicating the 95% CI. The y axis shows the effect of SNPs on the outcome, and the x axis shows the effect of SNPs on exposure. (C) Forest plot of MR analysis results for each ARG1 -associated SNP; the red line represents the pooled effect of all SNPs, indicating that increased ARG1 expression is associated with reduced ischemic stroke risk. (D) MR sensitivity analysis for ARG1 after removing SNPs using the leave-one-out method. The red line represents the pooled results for all SNPs. (E) Funnel plot of 11 SNPs on MR analysis.

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Mendelian randomization identifies ARG1 as a causal protective factor for IS (A) Forest plot of MR model results. (B) Scatterplot of the five MR models. Each point represents an IV, with the line on each point indicating the 95% CI. The y axis shows the effect of SNPs on the outcome, and the x axis shows the effect of SNPs on exposure. (C) Forest plot of MR analysis results for each ARG1 -associated SNP; the red line represents the pooled effect of all SNPs, indicating that increased ARG1 expression is associated with reduced ischemic stroke risk. (D) MR sensitivity analysis for ARG1 after removing SNPs using the leave-one-out method. The red line represents the pooled results for all SNPs. (E) Funnel plot of 11 SNPs on MR analysis.

Article Snippet: Primer Arg1 F: TGCTGAAGGACACCTTTGCT , This paper , Sangon Biotech.

Techniques: Expressing

Single-cell RNA-seq reveals Arg1 is specifically expressed in mouse IS brain cell subsets (A and B) The cellular distribution of 8 cell clusters between sham and MCAO mice. (C)The bar plot shows the cell ratio between ischemic stroke mice and sham mice. (D) The cellular distribution of Arg1 in MCAO mice. (E) The cellular distribution of Arg1 between sham and MCAO mice.

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Single-cell RNA-seq reveals Arg1 is specifically expressed in mouse IS brain cell subsets (A and B) The cellular distribution of 8 cell clusters between sham and MCAO mice. (C)The bar plot shows the cell ratio between ischemic stroke mice and sham mice. (D) The cellular distribution of Arg1 in MCAO mice. (E) The cellular distribution of Arg1 between sham and MCAO mice.

Article Snippet: Primer Arg1 F: TGCTGAAGGACACCTTTGCT , This paper , Sangon Biotech.

Techniques: Single Cell, RNA Sequencing

Single-cell RNA-seq of human PBMCs identifies ARG1 expression in IS patient immune subsets (A) Cell clusters were identified with UMAP projection of 90751 cells from controls and patients who had a stroke. (B) Bar plot of PBMC subset proportion between controls and IS patients. (C) Mean expression level of ARG1 in PBMC subtypes.

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Single-cell RNA-seq of human PBMCs identifies ARG1 expression in IS patient immune subsets (A) Cell clusters were identified with UMAP projection of 90751 cells from controls and patients who had a stroke. (B) Bar plot of PBMC subset proportion between controls and IS patients. (C) Mean expression level of ARG1 in PBMC subtypes.

Article Snippet: Primer Arg1 F: TGCTGAAGGACACCTTTGCT , This paper , Sangon Biotech.

Techniques: Single Cell, RNA Sequencing, Expressing

Relative mRNA expression levels of Arg1 , Vim , and Prpf31 : Comparison between MCAO rats and healthy control rats (A–C) Relative mRNA expression levels of Arg1 (A), Vim (B), and Prpf31 (C) in MCAO rats vs. healthy control rats. ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05 by Wilcoxon rank-sum test.

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Relative mRNA expression levels of Arg1 , Vim , and Prpf31 : Comparison between MCAO rats and healthy control rats (A–C) Relative mRNA expression levels of Arg1 (A), Vim (B), and Prpf31 (C) in MCAO rats vs. healthy control rats. ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05 by Wilcoxon rank-sum test.

Article Snippet: Primer Arg1 F: TGCTGAAGGACACCTTTGCT , This paper , Sangon Biotech.

Techniques: Expressing, Comparison, Control